Human BTNL8 3'UTR miRNA Target Clone in vector pEZX-MT06
Gene Information | |
---|---|
Gene Symbol: | BTNL8 |
Organism: | Homo sapiens |
Gene ID: | 79908 |
Accn.No.: | NM_001040462.1 |
Vector Information | |
---|---|
Vector: | pEZX-MT06 |
Reporter Gene: | Firefly luciferase |
Tracking Gene: | Synthetic Renilla luciferase |
Format: | transfection-ready purified DNA |
![]() |
3'UTR Sequence
gatgaatcacatcccacattcttctttagggatattaaggtctctctcccagatccaaagtcccgcagcagccggccaaggtggcttccagatgaagggggactggcctgtccacatgggagtcaggtgtcatggctgccctgagctgggagggaagaaggctgacattacatttagtttgctctcactccatctggctaagtgatcttgaaataccacctctcaggtgaagaaccgtcaggaattcccatctcacaggctgtggtgtagattaagtagacaaggaatgtgaataatgcttagatcttattgatgacagagtgtatcctaatggtttgttcattatatta...
Disclaimer
The NCBI identifiers above serve as a point of reference only. The sequence of the constructs offered may differ from the sequence published, e.g. by representing an alternative RNA splicing form or due to naturally occurring variations like single nucleotide polymorphisms (SNPs).
More Vector / Reporter Gene Options (1)
- Catalog Number
HmiT019378-MT06-GC - Supplier
GeneCopoeia - Size
- Shipping
Blue Ice
Price
794,00 €