Human THRA 3'UTR miRNA Target Clone in vector pEZX-MT05
| Gene Information | |
|---|---|
| Gene Symbol: | THRA |
| Organism: | Homo sapiens |
| Gene ID: | 7067 |
| Accn.No.: | NM_199334.2 |
| Vector Information | |
|---|---|
| Vector: | pEZX-MT05 |
| Selection Marker: | Neomycin |
| Reporter Gene: | Gaussia luciferase |
| Tracking Gene: | Secreted alkaline phosphatase |
| Format: | transfection-ready purified DNA |
 | |
3'UTR Sequence
agcctcaggcggccagagggtgtgcggagctggtggggaggagcctggagagaaggggcagagctgggggctgagggagacccccccacaccccttctctccttcctctcgtccttggatagattcagctcccacacacacacccgcactgcccaggtccctcctcagacctccagccctgggacagggcaaacaactgaacttgctatggaaaggacagtgtgggaggctgggggagctgtgtcctgcagttcccaggaccccatcctctcagaaggtaggggaagggcgggaggattgagaagggacaagccaccttgaccgtaggggaaggaggaatgtgggctggg...
Disclaimer
The NCBI identifiers above serve as a point of reference only. The sequence of the constructs offered may differ from the sequence published, e.g. by representing an alternative RNA splicing form or due to naturally occurring variations like single nucleotide polymorphisms (SNPs).
More Vector / Reporter Gene Options (1)
- Catalog Number
HmiT018078-MT05-GC - Supplier
GeneCopoeia - Size
- Shipping
Blue Ice
Price
794,00 €
