BioCat GmbH • Im Neuenheimer Feld 584 • D-69120 Heidelberg • Tel.: +49(0)6221 7141516
Home -> Genomics -> Genome Engineering -> CRISPR Cas9 SmartNuclease Genome Engineering System: AAV vector-based for in vivo applications

CRISPR Cas9 SmartNuclease Genome Engineering System: AAV vector-based for in vivo applications

AAV-Cas9 SmartNuclease System
Bringing together the versatile CRISPR/Cas9 genome editing system with powerful recombinant AAV (rAAV) technology, SBI’s AAV-Cas9 SmartNuclease vectors extend genome editing capabilities to cutting edge in vivo applications.

• Deliver Cas9 in vivo
• Edit genomes in post-natal animals
• Develop gene therapies in small animal models
• Generate novel disease models
• Choose from all-in-one or two-vector AAV-Cas9 systems


Why AAV?
With their broad tropism, the lack of disease associated with wild-type virus, ability to transduce both dividing and non-dividing cells, and long term transgene expression, recombinant AAV (rAAV) has recently become the method of choice for delivering gene therapy and genome engineering vectors to intact organisms (Vasileva A, 2005; Petrs-Silva H, 2013). However, for efficient packaging, inserts into the region between rAAV’s two ITR sequences must be less than 5 kb.

Why saCas9?
The development of CRISPR/Cas9 has already revolutionized what’s possible when it comes to manipulating the genomes of even complex organisms. However, in vivo delivery via rAAV vectors has been hampered by the size of the Streptococcus pyogenes Cas9 gene (spCas9), the most widely-used form of Cas9. To overcome this problem, Ran, et al,1 characterized smaller orthologs of the Cas9 gene and found that Cas9 from Staphylococcus aureus (saCas9) performs as efficiently as spCas9 while being ~1 kb shorter, enabling insertion into rAAV vectors.

Why SBI for AAV-Cas9?
With advanced rAAV systems and a range of easy-to-use Cas9 vectors and kits, SBI has the expertise to combine these two technologies into a single, easy-to-use, and powerful system. Choose from our all-in-one or two-vector systems to drive your in vivo genome editing studies into high gear.


Using saCas9
While saCas9 is just as efficient as spCas9, a few differences between the two systems will affect gRNA design:

• saCas9 PAM differs from spCas9 PAM
• saCas9 works most efficiently with gRNAs of 21 nt – 23 nt.


Contact us with any questions on gRNA design for saCas9 or about using our AAV-Cas9 vectors by emailing info@biocat.com.


saCas9 PAM sequences:

NNGGGT
NNGAAT
NNGAGT

To create gRNAs, use the following:

Fwd-5.1: ACCGNNNNNNNNNNNNNNNNNNNNN (N target sequence or gRNA sequence, 21 nts)
Rev-3.1: aaacXXXXXXXXXXXXXXXXXXXXX (X reverse complementary of N, 21 nts)

Example:
aavs1 gRNA for saCas9: CTGTCCCTAGTGGCCCCACTG
sa-AAVS1gRNA-5.1 ACCGCTGTCCCTAGTGGCCCCACTG
sa-AAVS1gRNA-3.1 aaacCAGTGGGGCCACTAGGGACAG


AAV-Cas9 Two-vector System
For situations where you would like to introduce saCas9 and gRNA separately, SBI offers a two-vector AAV-Cas9 system with saCas9 expressed on one vector using the strong, constitutive EF1α promoter (EF1a-hsaCas9 SmartNuclease AAV Plasmid, Cat# CASAAV200PA-1-SBI) and gRNA expressed on a separate vector using the U6 shRNA promoter (EF1-RFP-U6-gRNA(SA) SmartNuclease AAV Plasmid, Cat# CASAAV300PA-1-SBI). Please see the section on Using saCas9 for guidance on gRNA design with the saCas9 system.

The gRNA-expressing vector also contains a monomeric RFP fluorescent marker driven by an EF1α promoter to verify transduction efficiency.

Image
Image


AAV-Cas9 All-In-One vector
For the most streamlined in vivo introduction of Cas9 using rAAV technology, SBI offers an easy-to-use all-in-one AAV-Cas9 vector (EF1a-hsaCas9-U6-gRNA(SA) all-in-one SmartNuclease AAV Plasmid, #CASAAV100PA-1-SBI). Simply clone in your gRNA sequence, package the vector, and isolate rAAV virus particles using our AAVanced AAV concentration reagent for easy, high titer preparations.

The saCas9 gene is constitutively driven by the strong EF1α promoter with the gRNA driven by a U6 shRNA promoter (please see the section on Using saCas9 for guidance on gRNA design).

Image


Sample AAV-Cas9 Data
Both SBI’s all-in-one AAV-Cas9 and two-vector AAV-Cas9 systems efficiently correct a dysfunctional genomic copy of EGFP.

Starting with an Enhanced Green Fluorescent Inhibited Protein (EGIP) reporter cell line, which has an inactivated EGFP due to a premature stop codon, we designed a gRNA sequence to remove the stop codon and enable GFP expression in conjunction with a rescue HR donor. The gRNA sequence was inserted into either Cat # CASAAV300PA-1-SBI, EF1-RFP-U6-gRNA(SA) —the gRNA-expressing plasmid in the two-vector AAV-Cas9 system (top panels)—or Cat # CASAAV100PA-1-SBI, the All-in-One saCas9 & gRNA AAV vector (bottom panels). AAV virus particles isolated from both cell lysates (left panels) and packaging supernatants (right panels) were delivered to cells with the rescue HR donor and restored EGFP expression, indicating successful genome editing. Delivery of AAV plasmid(s) alone (middle panels) with HR donor also restored EGFP expression, again indicating successful genome editing.

Image
Efficient correction of a dysfunctional genomic copy of EGFP by all-in-one AAV-Cas9 and two-vector AAV-Cas9 systems
Approximately 1 – 1.5 x 106 EGIP reporter cells were seeded into a 12-well plate for infection with isolated AAV particles (left and right panels) or transfection with plasmid (middle panels), along with the rescue HR donor. The top panels were treated with the AAV-Cas9 two-vector system + donor designed to correct the defect in EGIP, restoring EGFP expression. The bottom panels were treated with the AAV-Cas9 All-in-one system + donor. Three days post-infection/or transfection, EGFP-positive cells can clearly be seen, indicating successful genome editing.


Reference
Ran, F. A. et al. (2015) In vivo genome editing using Staphylococcus aureus Cas9. Nature 520, 186–191.

 

Description Cat# Size Price    
EF1a-hsaCas9-U6-gRNA(SA) linearized all-in-one SmartNuclease AAV Plasmid CASAAV100PA-1-SBI 10 rxn 774 € DETAILS   Add to Cart 
EF1a-hsaCas9 SmartNuclease AAV Plasmid CASAAV200PA-1-SBI 10 ug 704 € DETAILS   Add to Cart 
EF1-RFP-U6-gRNA(SA) linearized SmartNuclease AAV Plasmid CASAAV300PA-1-SBI 10 rxn 674 € DETAILS   Add to Cart 

BioCat Autumn Special

Autumn Special

Browse our list of promotions and purchase your products of interest at a very special rate.

50 Euro Voucher

Email Newsletter

Subscribe to the BioCat Email Newsletter and receive a 50 € voucher.

Clone Resources

BioCat Clone Resources

Browse two of the most renowned clone resources of full-length cDNA, ORF, and shRNA clones as well as siRNA and yeast knockout strains.

Genome Engineering

Genome Engineering

Use the CRISPR/Cas9 SmartNuclease System to edit the genome.

ExoQuick and ExoQuick-TC

ExoQuick Exosome Isolation

Benefit from the most cited exosome isolation reagent for efficient exosome isolation and exosomal RNA purification from biofluids or culture media.

Support

Request a Catalog
Join our Mailing List
Contact us

Home
Imprint / Impressum
Top of Page Up!