Product Search

Use the Product Search to easily find your product of interest. You can search for:

Catalog number
K31 will return all products starting with this term, e.g. K311-400-BV

Product name or key word(s)
Wildcards (*) are set automatically, i.e. west will return products containing the term western but also West Nile Virus

BioCat GmbH • Im Neuenheimer Feld 584 • D-69120 Heidelberg • Tel.: +49(0)6221 7141516
hsa-miR-548b-3p LightSwitch miRNA Inhibitor (CAAGAACCUCAGUUGCUUUUGU) Order
Cat#: INH0532-SW
Quantity: 5 nmol
Price: 195 €
Supplier: SwitchGear Genomics
Data Sheet   User Manual  

DNA Methylation Kits

Benefit from outstanding cytosine conversion rates and fast protocols using DNA Bisulfite Modification Kits

Clone Search Service

Are you looking for cDNA, ORF, genomic or RNAi clones specific for your target gene(s)? Let us do the search for you! ...more

Home   
Top of Page Up!