Product CartmiRNA Reporter Constructs with RenSP Luciferase as Reporter
• Use as a positive control in miRNA target validation studies
• Use as a biosensor to measure relative levels of endogenous miRNA in your cell line
• Quantitative analysis: Expression and activity of miRNAs are measured through repression of RenSP luciferase gene expression
• Use to determine whether a mimic or inhibitor experiment will be more appropriate in your cell line of interest
• Unique RenSP Luciferase reporter for highest sensitivity and dynamic range
• Optimized LightSwitch Assay Reagents available for direct single-step use of your cells in Luciferase assays
BioCat now offers SwitchGear´s synthetic miRNA target GoClone luciferase reporters as a complement to the endogenous human 3´UTR GoClones.
Each vector contains an optimized synthetic target consisting of sequence repeats that are fully complementary to a variety of human and human viral miRNAs cloned downstream of the RenSP reporter gene in the pLightSwitch_3UTR vector. The target region sequences are based on miRBase 16 annotations.
3’UTR Insert Sequencing Primers:
Forward: GGGAAGTACATCAAGAGCTTCGT
Reverse: CCCCCTGAACCTGAAACATAAA
For vector sequence and annotation file see link below.
Synthetic miRNA complementary sequences are cloned into the MCS to produce a hybrid transcript that contains the RenSP luciferase gene fused to synthetic miRNA target of interest.
The vector is also available without insert, as a control, or for cloning your own miRNA target of interest. See link below.
The SwitchGear Advantage: The novel RenSP Luciferase Technology
RenSP Luciferase allows you to measure miRNA levels with industry-leading sensitivity and dynamic range.
Our partner SwitchGear has created an optimized Renilla luminescent reporter gene, called RenSP, by increasing its overall enzymatic activity (light output) and adding a protein destabilization domain to decrease the half-life of the RenSP protein. Starting with a base sequence of the native Renilla gene, SwitchGear functionally screened thousands of synthetic gene sequence variants that included a variety of predicted improvements, and also removed transcription factor binding sites from the gene sequence that might confound expression measurements. As a result, SwitchGear created the RenSP luciferase that is significantly brighter than any other humanized version of Renilla luciferase.
In addition to these gene improvements SwitchGear formulated the optimized single-step-use LightSwitch Assay Reagents for excellent signal to noise ratios, and a bright and stable signal. See link below.
Experimental Data:
Synthetic miRNA targets respond more strongly than endogenous 3’UTR targets and can be used as positive controls: The response of a synthetic element to the appropriate miRNA was measured in HT-1080 or HeLa cells for a number of popular miRNAs. Briefly, 100ng of an individual reporter construct was co-transfected in triplicate with either a microRNA mimic or a non-targeting at a final concentration ranging from 20-50nM. The average luminescence was calculated for mimic replicates and was then divided by the average for non-targeting control replicates. For a particular cell-line, a strongly-repressed human 3′UTR target is displayed alongside the represssion observed for the synthetic target as the log2 ratio of mimic to non-targeting control signal.
Synthetic 3’UTR GoClones as biosensors for endogenous miRNAs: The level of endogenous miRNA in the cell (x-axis) is inversely correlated with knockdown of the synthetic target reporter fusion in the presence of a miRNA mimic. Low knockdown suggests that the cell line expresses high levels of a miRNA, indicating that a miRNA inhibitor may be more effective in that cell line. Here, we compared the level of knockdown observed in HeLa cells for 9 synthetic miRNA target reporters previously tested for microRNA abundance in HeLa as detected by oligonucleotide microarrays (Barad et al. Genome Research 2004 14:2486-2494). The Pearson’s correlation coefficient for these data was R=0.66.
Product Specifications:
5 ug purified plasmid DNA
Concentration 30ng/ul
Quality >1.75 260/280 ratio, sequence verified
LightSwitch GoClones should be used with LightSwitch Assay Reagents for maximum sensitivity, brightness, and dynamic range
Related Links
pLightSwitch_3UTR Vector Sequence and Annotation
Order Info for empty pLightSwitch_3UTR Vector
LightSwitch Assay Reagents
Endogenous 3UTR GoClone Reporter Constructs
LightSwitch: Platform for 3UTR and Promoter Reporter Assays
Protocol for Adherent Cells
High-throughput Transfection Protocol for GoClone Assays
Protocol for K562 Suspension Cells
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
Next
| Description | Cat# | Size | Price | ||
|---|---|---|---|---|---|
| hcmv-miR-UL112 GoClone Reporter Construct (Synthetic miRNA Target) | S880433-SW | 5 ug transfection-ready DNA | 430 € | DETAILS |
|
| hcmv-miR-UL148D GoClone Reporter Construct (Synthetic miRNA Target) | S880434-SW | 5 ug transfection-ready DNA | 430 € | DETAILS |
|
| hcmv-miR-UL22A GoClone Reporter Construct (Synthetic miRNA Target) | S880435-SW | 5 ug transfection-ready DNA | 430 € | DETAILS |
|
| hcmv-miR-UL22A* GoClone Reporter Construct (Synthetic miRNA Target) | S880436-SW | 5 ug transfection-ready DNA | 430 € | DETAILS |
|
| hcmv-miR-UL36 GoClone Reporter Construct (Synthetic miRNA Target) | S880437-SW | 5 ug transfection-ready DNA | 430 € | DETAILS |
|
| hcmv-miR-UL36* GoClone Reporter Construct (Synthetic miRNA Target) | S880438-SW | 5 ug transfection-ready DNA | 430 € | DETAILS |
|
| hcmv-miR-UL70-3p GoClone Reporter Construct (Synthetic miRNA Target) | S880439-SW | 5 ug transfection-ready DNA | 430 € | DETAILS |
|
| hcmv-miR-UL70-5p GoClone Reporter Construct (Synthetic miRNA Target) | S880440-SW | 5 ug transfection-ready DNA | 430 € | DETAILS |
|
| hcmv-miR-US25-1 GoClone Reporter Construct (Synthetic miRNA Target) | S880441-SW | 5 ug transfection-ready DNA | 430 € | DETAILS |
|
| hcmv-miR-US25-1* GoClone Reporter Construct (Synthetic miRNA Target) | S880442-SW | 5 ug transfection-ready DNA | 430 € | DETAILS |
|
| hcmv-miR-US25-2-3p GoClone Reporter Construct (Synthetic miRNA Target) | S880443-SW | 5 ug transfection-ready DNA | 430 € | DETAILS |
|
| hcmv-miR-US25-2-5p GoClone Reporter Construct (Synthetic miRNA Target) | S880444-SW | 5 ug transfection-ready DNA | 430 € | DETAILS |
|
| hcmv-miR-US33-3p GoClone Reporter Construct (Synthetic miRNA Target) | S880445-SW | 5 ug transfection-ready DNA | 430 € | DETAILS |
|
| hcmv-miR-US33-5p GoClone Reporter Construct (Synthetic miRNA Target) | S880446-SW | 5 ug transfection-ready DNA | 430 € | DETAILS |
|
| hcmv-miR-US4 GoClone Reporter Construct (Synthetic miRNA Target) | S880447-SW | 5 ug transfection-ready DNA | 430 € | DETAILS |
|
| hcmv-miR-US5-1 GoClone Reporter Construct (Synthetic miRNA Target) | S880448-SW | 5 ug transfection-ready DNA | 430 € | DETAILS |
|
| hcmv-miR-US5-2 GoClone Reporter Construct (Synthetic miRNA Target) | S880449-SW | 5 ug transfection-ready DNA | 430 € | DETAILS |
|
| hiv1-miR-H1 GoClone Reporter Construct (Synthetic miRNA Target) | S880450-SW | 5 ug transfection-ready DNA | 430 € | DETAILS |
|
| hiv1-miR-N367 GoClone Reporter Construct (Synthetic miRNA Target) | S880451-SW | 5 ug transfection-ready DNA | 430 € | DETAILS |
|
| hiv1-miR-TAR-3p GoClone Reporter Construct (Synthetic miRNA Target) | S880452-SW | 5 ug transfection-ready DNA | 430 € | DETAILS |
|
| hiv1-miR-TAR-5p GoClone Reporter Construct (Synthetic miRNA Target) | S880453-SW | 5 ug transfection-ready DNA | 430 € | DETAILS |
|
| let-7a GoClone Reporter Construct (Synthetic miRNA Target) | S880001-SW | 5 ug transfection-ready DNA | 430 € | DETAILS |
|
| let-7a* GoClone Reporter Construct (Synthetic miRNA Target) | S880454-SW | 5 ug transfection-ready DNA | 430 € | DETAILS |
|
| let-7a-2* GoClone Reporter Construct (Synthetic miRNA Target) | S880455-SW | 5 ug transfection-ready DNA | 430 € | DETAILS |
|
| let-7b GoClone Reporter Construct (Synthetic miRNA Target) | S880002-SW | 5 ug transfection-ready DNA | 430 € | DETAILS |
|
| let-7b* GoClone Reporter Construct (Synthetic miRNA Target) | S880456-SW | 5 ug transfection-ready DNA | 430 € | DETAILS |
|
| let-7c GoClone Reporter Construct (Synthetic miRNA Target) | S880003-SW | 5 ug transfection-ready DNA | 430 € | DETAILS |
|
| let-7c* GoClone Reporter Construct (Synthetic miRNA Target) | S880457-SW | 5 ug transfection-ready DNA | 430 € | DETAILS |
|
| let-7d GoClone Reporter Construct (Synthetic miRNA Target) | S880004-SW | 5 ug transfection-ready DNA | 430 € | DETAILS |
|
| let-7d* GoClone Reporter Construct (Synthetic miRNA Target) | S880458-SW | 5 ug transfection-ready DNA | 430 € | DETAILS |
|
| let-7e GoClone Reporter Construct (Synthetic miRNA Target) | S880005-SW | 5 ug transfection-ready DNA | 430 € | DETAILS |
|
| let-7e* GoClone Reporter Construct (Synthetic miRNA Target) | S880459-SW | 5 ug transfection-ready DNA | 430 € | DETAILS |
|
| let-7f GoClone Reporter Construct (Synthetic miRNA Target) | S880006-SW | 5 ug transfection-ready DNA | 430 € | DETAILS |
|
| let-7f-1* GoClone Reporter Construct (Synthetic miRNA Target) | S880460-SW | 5 ug transfection-ready DNA | 430 € | DETAILS |
|
| let-7f-2* GoClone Reporter Construct (Synthetic miRNA Target) | S880461-SW | 5 ug transfection-ready DNA | 430 € | DETAILS |
|
| let-7g GoClone Reporter Construct (Synthetic miRNA Target) | S880007-SW | 5 ug transfection-ready DNA | 430 € | DETAILS |
|
| let-7g* GoClone Reporter Construct (Synthetic miRNA Target) | S880462-SW | 5 ug transfection-ready DNA | 430 € | DETAILS |
|
| let-7i GoClone Reporter Construct (Synthetic miRNA Target) | S880008-SW | 5 ug transfection-ready DNA | 430 € | DETAILS |
|
| let-7i* GoClone Reporter Construct (Synthetic miRNA Target) | S880463-SW | 5 ug transfection-ready DNA | 430 € | DETAILS |
|
| miR-1 GoClone Reporter Construct (Synthetic miRNA Target) | S880009-SW | 5 ug transfection-ready DNA | 430 € | DETAILS |
|
| miR-100 GoClone Reporter Construct (Synthetic miRNA Target) | S880010-SW | 5 ug transfection-ready DNA | 430 € | DETAILS |
|
| miR-100* GoClone Reporter Construct (Synthetic miRNA Target) | S880527-SW | 5 ug transfection-ready DNA | 430 € | DETAILS |
|
| miR-101 GoClone Reporter Construct (Synthetic miRNA Target) | S880011-SW | 5 ug transfection-ready DNA | 430 € | DETAILS |
|
| miR-101* GoClone Reporter Construct (Synthetic miRNA Target) | S880528-SW | 5 ug transfection-ready DNA | 430 € | DETAILS |
|
| miR-103 GoClone Reporter Construct (Synthetic miRNA Target) | S880012-SW | 5 ug transfection-ready DNA | 430 € | DETAILS |
|
| miR-103-2* GoClone Reporter Construct (Synthetic miRNA Target) | S880529-SW | 5 ug transfection-ready DNA | 430 € | DETAILS |
|
| miR-103-as GoClone Reporter Construct (Synthetic miRNA Target) | S880013-SW | 5 ug transfection-ready DNA | 430 € | DETAILS |
|
| miR-105 GoClone Reporter Construct (Synthetic miRNA Target) | S880014-SW | 5 ug transfection-ready DNA | 430 € | DETAILS |
|
| miR-105* GoClone Reporter Construct (Synthetic miRNA Target) | S880530-SW | 5 ug transfection-ready DNA | 430 € | DETAILS |
|
| miR-106a GoClone Reporter Construct (Synthetic miRNA Target) | S880015-SW | 5 ug transfection-ready DNA | 430 € | DETAILS |
|
